Prevalence of Hepatitis B Virus (HBV) Basal Core Promoter/ Precore Region Molecular Variants among HIV/HBV Co-infected and HBV Mono-Infected Patients in Ile-Ife, Nigeria

Study Location and Sample Collection

This work is a cross-sectional hospital-based study carried out in the southwestern part of Nigeria, at the virology clinic of the Obafemi Awolowo University Teaching Hospital, Ile-Ife. Ethical approval was granted by Obafemi Awolowo University Teaching Hospital, Ile-Ife and London School of Hygiene and Tropical Medicine Review Boards respectively. The study design conformed to the 2013 declaration of Helsinki. Socio-demographic data and clinical information were collected from each participant at the time of sample collection using self-administered structured questionnaire. Twenty HIV/HBV co-infected patients reporting at the virology clinic were recruited through purposive sampling technique involving screening of all HIV positive adult patients (250) for HbsAg. Twenty patients (8%) were found positive for HBsAg among the HIV positive patients; we also recruited same number (20) of known HBV mono-infected adult patients from the clinic who tested positive for HBsAg to have a basis for comparison of mutation rates in these two subgroups of patients. Study was conducted between May to August, 2019.

Five (5) millilitres of blood were collected from each participant by phlebotomist into Labelled EDTA bottle using sterile needles and syringes after sterilizing the venepuncture site with 70 % ethanol soaked cotton wool. Blood samples were separated immediately by centrifugation at 1,500g for 15 min, and two plasma aliquots were aspirated into labeled sterile cryovials. The labeled cryovials containing plasma samples were transported on ice to the Department of Virology, College of Medicine, University College Hospital, and Ibadan where they were preserved at 800C until analysis.

Detection of HBsAg, HBeAg and Anti-HBe Antibody Assay

All the 250 HIV positive plasma samples from patients enrolled into the study were initially screened for HBsAg using one step HBsAg strip (ACON Laboratories incorporated, USA) of which twenty (20) (8%) HIV positive patients tested positive for HBsAg. Another 20 HBV mono-infected patients (previously tested HBV positive at the centre) enrolled into the study were equally screened using one step HBsAg strip. All 40 plasma samples positive for HBsAg (including 20 plasma samples of HIV/HBV co-infected patients and 20 plasma samples of HBV mono infected patients) were subsequently subjected to HBsAg, HBeAg and HbeAb specific Enzyme-Linked Immunosorbent Assay (ELISA) (MELSIN Diagnostic kits China). Both the one-step HBsAg strip and ELISA assay were performed according to the manufacturer’s instructions. For the ELISA assay, optical density (OD) was read using the Emax endpoint ELISA microplate reader (Molecular Devices, California, USA) and the interpretation was made in line with the manufacturer’s instructions.

Nucleic acid extraction and HBV partial S-gene amplification

Total nucleic acid was isolated from all Hepatitis B surface antigen (HBsAg) ELISA positive plasma samples (n=40) using Jena Bioscience viral RNA+DNA Preparation Kit. The extraction was done following the manufacturer’s instruction. The HBsAg specific polymerase chain reaction was carried out using a nested PCR (nPCR) targeting the partial S-gene region as previously described [10, 11]. The first-round primers used were HBV_S1F (CTAGGACCCCTGCTCGTGTT), and HBV_S1R (CGAACCACTGAACAAATGGCACT), while the second-round primers were HBV_SNF (5-GTTGACAAGAATCCTCACAATACC-3) and HBV_SNR (5-GAGGCCCACTC CCATA-3). Both the first and second- round PCR reaction conditions were similar except that for first-round PCR, DNA extract from the sample was used as a template while first-round PCR product was used as a template for second-round PCR. PCR amplification was performed with a total volume of 50μL reaction containing 10μL of Red load Taq (Jena Bioscience, Jena, Germany), two microliters of each primer (made in 25μM concentrations), 4μL of DNA and 32μL of RNase free water. Thermal cycling was done using Veriti Thermal cycler (Applied Bio systems, California, USA.) as follows; 94°C for 3 minutes, followed by 45 cycles (denaturation; 94°C for 30 seconds, annealing; 55°C for 60 seconds and elongation; 70°C for 40 seconds with a ramp of 40% from 55°C to 70°C). After that, the reaction was further elongated at 72°C for 7 minutes and held at 4°C till terminated. Finally, PCR products were resolved on 2% agarose gel stained with ethidium bromide and viewed using a UV transilluminator.

HBV Basal Core Promoter and Precore (BCP/ PC) Region Amplification

The BCP/PC genome regions (nucleotide (nt) 1653- 1959) were amplified using a nested PCR assay and reaction mixture previously reported [12]. Briefly, 5 μL of the extracted DNA was mixed with 45μL of a PCR reaction mixture containing 400nM of the outer forward primers (5’-GCATGGAGACCACCGTGAC-3’) and reverse primers (5’-GGAAAGAAGTCCGAGGGCAA-3’ in the first round PCR reaction. Nested PCR was carried out using forward primers (5’–CATAAGAGGACTCTTGGACT-3’ and reverse primers (5’- GGCAAAAAACAGAGTAACTC-3’) in the second round PCR reaction. The polymerase chain reaction thermal cycling condition was done as follows: 940 C for 30sec, followed by 30 cycles (denaturation: 940C for 30 sec ,annealing: 550C for 60 sec, elongation : 720C for 40seconds), final extension: 720C for 2 minutes. Reaction mixture concentration and conditions for PCR were similar for both the first and second- round PCR except that the cycles were increased to 35 cycles in the second-round amplification and first-round PCR products were used as template for second-round PCR. All PCR products were resolved on 1.5% agarose gel stained with ethidium bromide and viewed using a UV transilluminator.

Amplicon Sequencing

All PCR products that were positive for both HBV partial S-genes and BCP/PC specific polymerase chain reaction by having the required amplicon sizes (450 and 306 bp respectively) after viewing using a UV transilluminator were shipped to Macrogen Europe, Netherland for PCR product purification and BigDye chemistry sequencing. Second round primers for each assay were used for sequencing.

Phylogenetic Analysis and Inference of Serotypes

The forward and reverse sequencing results per isolate for both S-gene and BCP/PC sequences were merged into contigs, and thereafter subjected to a BLASTn search on the NCBI BLAST webpage. GenBank sequences with high matching scores were retrieved and retained for downstream multiple sequence alignment for both genotyping and BCP/ PC mutational analysis. Phylogenetic analysis in this study was performed as previously described [13, 14], and HBV serotypes were predicted based on analysis of amino acid residues at positions 122, 127, 134 and 160 specifying HBsAg determinants in the S region. Nucleotide sequences of S genes were retrieved from the HBV database (http://hbvdb. ibcp.fr/HBVdb/), and alignment done using the CLUSTAL W program in MEGA X software with default settings. Phylogenetic tree was constructed in MEGA X software with the Kimura-2 parameter model [15, 16] and 1,000 bootstrap replicates was used to construct a neighbour-joining tree.

BCP/PC Gene Variability Analysis

For BCP/PC mutational analysis, each sequence from this study were compared against known wild-type GenBank Genotype E reference sequences: X75657 and previously reported BCP/PC nucleotide sequences in Africa [17, 18], using the CLUSTAL W program in MEGA X software with default settings [13]. Focus was given to major BCP/ PC mutational genome sites affecting HBeAg expression especially at the BCP transcriptional (BCP double mutations; A1762T/G1764A) and translational sites (Kozak sequences mutants, nt1809-1812), and PC initiation (1814-1816). PC translational stop codon (G1896A with C1858T) and post translational mutant gene (G1862T) were equally examined [17, 18, 19]. Additionally, nucleotide changes in other BCP functional genome regions including the TA rich genome regions (nt1741-1755, nt1758-1762, nt1771-1775, and nt1788-1795) as well as initiation sites of PC mRNA at nt1788-1791 and pregenomic RNA at nt1817-1821 were also examined [18, 19]. All mutant variants detected were compared among the two study groups.

DNA Sequence Accession Numbers

The HBV BCP/PC sequences generated in this study have been deposited into National Centre for Biotechnology Information (NCBI) GenBank under accession number MT680878-MT680883.

Statistical Analysis

Accuracy and completeness of questionnaires were checked; data were double entered to reduce data entry errors and later merged. All categorical data and median (interquartile range, IQR) of continuous variables were compared by Chi-square and Mann-Whitney tests, respectively using SPSS version 25.0 (IBM, USA). The Optical density (O.D.) values of HBeAg and HbeAb were also compared between the study groups by Mann-Whitney test using GraphPad Prism (version 8.4.2, 2020). For all statistical analyses, P-value less than 0.05 were considered significant at 95% CI.

Demographic Characteristics of Study Participants

The mean age of HIV/HBV co-infected patients was 40 years while HBV mono-infected patients was 30.5 years (p = 0.000). Overall, female had the highest seroprevalence of HBV infection among the two studied groups (62.5%, p = 0.003) (Table 1).

HbeAg and HbeAb ELISA Screening and Genotypic Analysis

Frequency of HBeAg and HBeAb varied across the two studied groups. Highest (23%) frequency of HBeAg was observed in the HIV/HBV co-infected group. Also, higher (60%) frequency of HBeAb was observed among the HBV mono-infected group (Figure 1). Genotypic analysis of the sequences (3 exploitable sequences) that were positive for S-gene specific nPCR showed that all the sequences belonged to genotype E (Figure 2).

Click to enlarge

Click to enlarge

Variation Analysis of the BCP/PC Region

Of the 40 samples tested by BCP/PC region-specific nested PCR, 17 (42.5%) of the samples yielded the expected 306 bp. Specifically,12 and 5 samples from patients with HBV/HIV co-infection and HBV mono-infection respectively as shown by macrogen preliminary gel report in Figure 3.

However, out of the 17 samples, seven (7) samples had low concentration/volume and were not sequenced while the remaining ten samples were sequenced. Of the ten samples, sequence data of four samples were not exploitable due to the presence of multiple peaks. Sequence data of the remaining exploitable six (6) sequences were used for the BCP/PC mutational analysis.

Click to enlarge

Overall, 5(83.3%) of the 6 exploitable sequences after analysis showed various BCP/PC mutations (Figure 3). Interestingly, only 1 (16.6%) sequence from an HIV/ HBV co-infected patient showed the BCP transcriptional (double mutation; A1762T/G1764A) mutant. There was no significant Kozak sequence (nt1809-1812) or PC initiation codon (nt1814-1816) mutants detected. Analysis of the PC translational stop codon showed 4(66.6%) having the G1896A mutants while 2 (33.3%) had G1899A mutants (Figure 4). None of the sequences in this study had the PC post-translational mutant variant (G1862T) (Figure 5).

Click to enlarge

Click to enlarge